You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
ydfC [2019-08-28 10:07:42]
Genomic Context
categories
[category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins][category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]Gene
Coordinates
582,536 → 583,456
The protein
Protein family
[SW|EamA transporter family] (according to UniProt)[SW|Domains]
[SW|EamA domain] 1 (aa 17-140) (according to UniProt)[SW|EamA domain] 2 (aa 160-285) (according to UniProt)[SW|Localization]
cell membrane (according to UniProt)Biological materials
Mutant
MGNA-C143 (ydfC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2141 NBRP B. subtilis, Japan]BKE05360 (Δ[gene|DB6054A37D2EC1C1961C49825AF74171FADF1A3B|ydfC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCTCACTCCTCTTT, downstream forward: _UP4_TAAAACAAAAAAGATACCAABKK05360 (Δ[gene|DB6054A37D2EC1C1961C49825AF74171FADF1A3B|ydfC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCTCACTCCTCTTT, downstream forward: _UP4_TAAAACAAAAAAGATACCAA